View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14743_high_7 (Length: 246)
Name: NF14743_high_7
Description: NF14743
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14743_high_7 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 163; Significance: 4e-87; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 163; E-Value: 4e-87
Query Start/End: Original strand, 29 - 246
Target Start/End: Complemental strand, 43971769 - 43971551
Alignment:
| Q |
29 |
caacacccacatctccttcaaaatcgagacgaggtaaagtcattgctatgtcgttcacgacacctagttgctcgcttttcccctcattactaatttttaa |
128 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||| |||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43971769 |
caacacccacatctccttcaaaatcaagacgaggtaaagtcattgctatatcgttcacgaaacctagttgctcgcttttcccctcattactaatttttaa |
43971670 |
T |
|
| Q |
129 |
agttctgacattgcttaatgaatataaactgaatcttactcaaataattgtattgtttgtttttcgatggg-nnnnnnnngtgttaatcctactgttttt |
227 |
Q |
| |
|
|||||||||||||||| | ||||||||||||||| |||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
43971669 |
agttctgacattgctttacgaatataaactgaattttactcaaataattgtattgtttgtttttcgatgggtttttttttgtgttaatcctactgttttt |
43971570 |
T |
|
| Q |
228 |
agggaaaagaaactctaat |
246 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
43971569 |
agggaaaagaaactctaat |
43971551 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University