View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14743_low_13 (Length: 233)
Name: NF14743_low_13
Description: NF14743
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14743_low_13 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 219; Significance: 1e-120; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 7 - 233
Target Start/End: Complemental strand, 45309760 - 45309534
Alignment:
| Q |
7 |
cttgataccctggagaaagcttttgctgccggtgataatggtttttgtagggccatcaccaaacatgaaaacatttggtttatccttgtcaacaaaaatg |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45309760 |
cttgataccctggagaaagcttttgctgccggtgataatggtttttgtagggccatcaccaaacatgaaaacatttggtttatccttgtcaacaaaaatg |
45309661 |
T |
 |
| Q |
107 |
tactcatcatatacaccactcttaatgtagataatgtgccttccttgatggttatttgggtatgcattaatagcatcaacaatagtcttatattgaccac |
206 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45309660 |
tactcatcatatacaccactcttagtgtagataatgtaccttccttgatggttatttgggtatgcattaatagcatcaacaatagtcttatattgaccac |
45309561 |
T |
 |
| Q |
207 |
tgccatccttggcaaccgttactaaaa |
233 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
45309560 |
tgccatccttggcaaccgttactaaaa |
45309534 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University