View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14743_low_15 (Length: 213)
Name: NF14743_low_15
Description: NF14743
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14743_low_15 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 147; Significance: 1e-77; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 147; E-Value: 1e-77
Query Start/End: Original strand, 14 - 196
Target Start/End: Complemental strand, 17395893 - 17395711
Alignment:
| Q |
14 |
agagaacatgagtttcgaatgttgcagttatgtgatatacagactcgacatgggtcatcaggacaactaccaaattggatgcataatagtcatgaatgga |
113 |
Q |
| |
|
||||||||| |||||| ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
17395893 |
agagaacattagtttcaaatgttgcagttatgtgatatgtagactcgacatgggtcatcaggacaactaccaaattgcatgcataatagtcatgaatgga |
17395794 |
T |
 |
| Q |
114 |
tggggtacctgcaaaattaccacaatagaaacaagaagaggatttcaagagagaaatttttcgacgaaagatatggaaaccct |
196 |
Q |
| |
|
||||||||||||||||||||||||| |||||||| |||||||||||||||||| |||||||||||||||||||||||| |||| |
|
|
| T |
17395793 |
tggggtacctgcaaaattaccacaacagaaacaaaaagaggatttcaagagagcaatttttcgacgaaagatatggaatccct |
17395711 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 147; E-Value: 1e-77
Query Start/End: Original strand, 14 - 196
Target Start/End: Complemental strand, 17399486 - 17399304
Alignment:
| Q |
14 |
agagaacatgagtttcgaatgttgcagttatgtgatatacagactcgacatgggtcatcaggacaactaccaaattggatgcataatagtcatgaatgga |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| ||||| ||||||||||||||||| ||||||||||||| |
|
|
| T |
17399486 |
agagaacatgagtttcgaatgttgcagttatgtgatatgcagactcgacatgggtcatcagggcaactcccaaattggatgcataacagtcatgaatgga |
17399387 |
T |
 |
| Q |
114 |
tggggtacctgcaaaattaccacaatagaaacaagaagaggatttcaagagagaaatttttcgacgaaagatatggaaaccct |
196 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||||||| ||||||||||| ||||||||||| |||| |
|
|
| T |
17399386 |
tggggtacctgcaaaattaccataatagaaacaagaagaggatttcaagagagcaatttttcgacataagatatggaatccct |
17399304 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University