View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14744_high_14 (Length: 307)
Name: NF14744_high_14
Description: NF14744
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14744_high_14 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 215; Significance: 1e-118; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 12 - 289
Target Start/End: Original strand, 372361 - 372647
Alignment:
| Q |
12 |
ataattctagtttacatttatctccaaagtttatatatataaactctatgcattgtggtgttgtttcttcatcatcataatcacacnnnnnnnnnnnnt- |
110 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
372361 |
ataattttagtttacatttatctccaaagtttatatatataaactctatgcattgtggtgttgtttcttcatcatcataatcacacatatatatatattt |
372460 |
T |
 |
| Q |
111 |
--------gttgagtgagactgagagaaaataacaaaagtagtaagtaatgcctctaccactgctttcactgaaccacgtctcttttgtatgtaggagtc |
202 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
372461 |
tgagtattgttgagtgagactgagagaaaataacaaaagtagtaagtaatgcctctaccactgctttcactgaaccacgtctcttttgtatgtaggagtc |
372560 |
T |
 |
| Q |
203 |
tgcaagagtctgtcaaattctatgagaatgtcctcggatttgtgctcattaagaggccatcttctttcaaatttcaaggggcttggt |
289 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
372561 |
tgcaagagtctgtcaaattctatgagaatgtcctcggatttgtgctcattaagaggccatcttctttcaaatttcaaggggcttggt |
372647 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University