View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14744_high_17 (Length: 245)

Name: NF14744_high_17
Description: NF14744
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14744_high_17
NF14744_high_17
[»] chr5 (1 HSPs)
chr5 (18-89)||(2139694-2139765)


Alignment Details
Target: chr5 (Bit Score: 72; Significance: 7e-33; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 72; E-Value: 7e-33
Query Start/End: Original strand, 18 - 89
Target Start/End: Complemental strand, 2139765 - 2139694
Alignment:
18 ggaaatagttgtccactaaattcccagctaaataaagagtttcatgctcgactccacctaatttaagtgttg 89  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
2139765 ggaaatagttgtccactaaattcccagctaaataaagagtttcatgctcgactccacctaatttaagtgttg 2139694  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University