View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14744_high_19 (Length: 232)

Name: NF14744_high_19
Description: NF14744
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14744_high_19
NF14744_high_19
[»] chr6 (1 HSPs)
chr6 (1-232)||(3115318-3115546)


Alignment Details
Target: chr6 (Bit Score: 176; Significance: 6e-95; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 176; E-Value: 6e-95
Query Start/End: Original strand, 1 - 232
Target Start/End: Complemental strand, 3115546 - 3115318
Alignment:
1 atttgaacaaattttgcttttcattgtattaagtgaaaccttcaacaacnnnnnnnnnnntctgagtgagatttctagccaatggaaaagtaaggttgga 100  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||             ||||||||||||||||||||||||||||||||||||||    
3115546 atttgaacaaattttgcttttcattgtattaagtgaaaccttcaacaacaaaaaaaaat---tgagtgagatttctagccaatggaaaagtaaggttgga 3115450  T
101 aagtagagaaatagtaaaaaataaagagaacctcagataaaggaacaccacaagcagtgacaaattcatctttaaatggaccctttaatagaacataata 200  Q
    ||||||||||||||||||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||    
3115449 aagtagagaaatagtaaaaaagaaagagaacctcagataaaggaacaccaccagcagtgacaaattcatctttaaatggaccctttaatagaacataata 3115350  T
201 gaaaacatgttatgtcaaagatgcttcataaa 232  Q
    |||||||||||||||||| |||||||||||||    
3115349 gaaaacatgttatgtcaatgatgcttcataaa 3115318  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University