View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14744_high_26 (Length: 201)
Name: NF14744_high_26
Description: NF14744
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14744_high_26 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 152; Significance: 1e-80; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 152; E-Value: 1e-80
Query Start/End: Original strand, 19 - 182
Target Start/End: Original strand, 3229805 - 3229968
Alignment:
| Q |
19 |
attaaactaaatcaaataaaacagtgataataataagaataatactaagatttagaatcggtaatgaagaacgttgaatctaagagaaaacgagacagat |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3229805 |
attaaactaaatcaaataaaacagtgataataataagaataatactaagatttagaatcgataatgaagaacgttgaatctaagagaaaacgagacagat |
3229904 |
T |
 |
| Q |
119 |
ctggattagggttttacctgttagggatacgagaagagaggaaattagggttttgtgtggttat |
182 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||| ||||||| |
|
|
| T |
3229905 |
ctggattagggttttacctgttagggatgcgagaagagaggaaattagggttttgtatggttat |
3229968 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University