View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14744_low_22 (Length: 232)
Name: NF14744_low_22
Description: NF14744
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14744_low_22 |
 | |
|
| [»] chr6 (1 HSPs) |
| |
|
Alignment Details
Target: chr6 (Bit Score: 176; Significance: 6e-95; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 176; E-Value: 6e-95
Query Start/End: Original strand, 1 - 232
Target Start/End: Complemental strand, 3115546 - 3115318
Alignment:
| Q |
1 |
atttgaacaaattttgcttttcattgtattaagtgaaaccttcaacaacnnnnnnnnnnntctgagtgagatttctagccaatggaaaagtaaggttgga |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3115546 |
atttgaacaaattttgcttttcattgtattaagtgaaaccttcaacaacaaaaaaaaat---tgagtgagatttctagccaatggaaaagtaaggttgga |
3115450 |
T |
|
| Q |
101 |
aagtagagaaatagtaaaaaataaagagaacctcagataaaggaacaccacaagcagtgacaaattcatctttaaatggaccctttaatagaacataata |
200 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3115449 |
aagtagagaaatagtaaaaaagaaagagaacctcagataaaggaacaccaccagcagtgacaaattcatctttaaatggaccctttaatagaacataata |
3115350 |
T |
|
| Q |
201 |
gaaaacatgttatgtcaaagatgcttcataaa |
232 |
Q |
| |
|
|||||||||||||||||| ||||||||||||| |
|
|
| T |
3115349 |
gaaaacatgttatgtcaatgatgcttcataaa |
3115318 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University