View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14745_high_14 (Length: 250)
Name: NF14745_high_14
Description: NF14745
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14745_high_14 |
 |  |
|
| [»] chr7 (3 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 167; Significance: 1e-89; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 167; E-Value: 1e-89
Query Start/End: Original strand, 5 - 250
Target Start/End: Original strand, 28216802 - 28217057
Alignment:
| Q |
5 |
aatttttctttggttgcattcagttcgtctcggcggttgctttcatgtcccagtacagattgaaattggtccataatcaccttcccaagtaaagcagagc |
104 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |||||||||||| |||||||||| ||| |
|
|
| T |
28216802 |
aatttttctttggttgcattcagttcgtctcggcggttgctttcatgtcccaatacagattgaaattggtccgtaatcaccttccgaagtaaagcacagc |
28216901 |
T |
 |
| Q |
105 |
g-----------ccacaagcatatcactagccttttccaacccagactccttcacctcctgcacatcttttgcgaagcttagattgctgtccacaaaacc |
193 |
Q |
| |
|
| |||||||||| ||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||||||| |
|
|
| T |
28216902 |
gaaggttgtatgccacaagcatctcactagccttttccaacccagactccttcacctcctgcacat-ttttgtgaagcttagattgctgtccacaaaacc |
28217000 |
T |
 |
| Q |
194 |
tattccatcgaaactcctgtcccgcagcgatgctttatcagtctcttccattgggac |
250 |
Q |
| |
|
|||||||| |||| |||||||| |||||||||||| |||||||||||||||||||| |
|
|
| T |
28217001 |
cattccatcaaaacacctgtcccacagcgatgctttttcagtctcttccattgggac |
28217057 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 139; E-Value: 8e-73
Query Start/End: Original strand, 5 - 226
Target Start/End: Original strand, 28237674 - 28237906
Alignment:
| Q |
5 |
aatttttctttggttgcattcagttcgtctcggcggttgctttcatgtcccagtacagattgaaattggtccataatcaccttcccaagtaaagcagag- |
103 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||| ||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28237674 |
aatttttctttggttgcattcagttcgtcttggcagttgctttcatgtcctagtacagattgaaattggtccataatcaccttcccaagtaaagcagagc |
28237773 |
T |
 |
| Q |
104 |
----------cgccacaagcatatcactagccttttccaacccagactccttcacctcctgcacatcttttgcgaagcttagattgctgtccacaaaacc |
193 |
Q |
| |
|
|||||||||||| |||||||| |||||||||||||||||||||||||||||||||||||||||||||| |||||| |||||||||||| | |
|
|
| T |
28237774 |
gaaggttgtacgccacaagcatctcactagctttttccaacccagactccttcacctcctgcacatcttttgcgaagcatagatttctgtccacaaaatc |
28237873 |
T |
 |
| Q |
194 |
tattccatcgaaactcctgtcccgcagcgatgc |
226 |
Q |
| |
|
|||||||| || |||| |||| ||||||||| |
|
|
| T |
28237874 |
cattccatcaaacctcccatcccacagcgatgc |
28237906 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 131; E-Value: 5e-68
Query Start/End: Original strand, 5 - 250
Target Start/End: Original strand, 28232845 - 28233101
Alignment:
| Q |
5 |
aatttttctttggttgcattcagttcgtctcggcggttgctttcatgtcccagtacagattgaaattggtccataatcaccttcccaagtaaagcagagc |
104 |
Q |
| |
|
|||||| ||||||||||| ||||||||||| ||| |||||| | |||||||| || || ||| ||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
28232845 |
aattttcctttggttgcaatcagttcgtcttggcagttgctatgatgtcccactaaagcttggaattggtccgtaatcaccttcccaagtaaagcagagc |
28232944 |
T |
 |
| Q |
105 |
g-----------ccacaagcatatcactagccttttccaacccagactccttcacctcctgcacatcttttgcgaagcttagattgctgtccacaaaacc |
193 |
Q |
| |
|
| ||||||| || |||| ||| |||||||||||||||||||||||||||||||| ||||||| ||||||||||||||||||||||||||| |
|
|
| T |
28232945 |
gaaggctgtacgccacaagaatctcaccagctttttccaacccagactccttcacctcctgcacgtcttttgtgaagcttagattgctgtccacaaaacc |
28233044 |
T |
 |
| Q |
194 |
tattccatcgaaactcctgtcccgcagcgatgctttatcagtctcttccattgggac |
250 |
Q |
| |
|
||||||||||| |||||||||| |||||||||| |||||||| ||||||||||||| |
|
|
| T |
28233045 |
cattccatcgaacctcctgtcccacagcgatgctatatcagtcccttccattgggac |
28233101 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University