View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14745_high_17 (Length: 234)
Name: NF14745_high_17
Description: NF14745
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14745_high_17 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 180; Significance: 2e-97; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 180; E-Value: 2e-97
Query Start/End: Original strand, 1 - 221
Target Start/End: Complemental strand, 38326670 - 38326458
Alignment:
| Q |
1 |
ctctcgcaattcggtttgtgacgaatcagtaacggcttggttctgtgtttctgaactgcgataacaattttgtttggtctagttcaattttattctcaaa |
100 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38326670 |
ctctcgcaattcagtttgtgacgaatcagtaacggcttggttctgtgtttctgaactgcgataacaattttgtttggtctagttcaattttattctcaaa |
38326571 |
T |
|
| Q |
101 |
cacaacaatagtctagttaatgtgactatctctctagacctctagttgcattcttttaaacagtaaaccaagggtggtgggtatgtgaagaagttagaat |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| | |||||||||||||||||||||| |
|
|
| T |
38326570 |
cacaacaatagtctagttaatgtgactatctct--------ctagttgcattcttttaaacagtaaaccaagggtagagggtatgtgaagaagttagaat |
38326479 |
T |
|
| Q |
201 |
gcaatcaattttgataaaatt |
221 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
38326478 |
gcaatcaattttgataaaatt |
38326458 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University