View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14745_low_11 (Length: 349)
Name: NF14745_low_11
Description: NF14745
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14745_low_11 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 261; Significance: 1e-145; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 261; E-Value: 1e-145
Query Start/End: Original strand, 1 - 333
Target Start/End: Complemental strand, 2632035 - 2631706
Alignment:
| Q |
1 |
actacaagaaatactaaaaattatcctggctcatgatgaaaggatgaatttctttcaaaattttggattcatacggttatacatctannnnnnnnnnnnn |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2632035 |
actacaagaaatactaaaaattatcctggctcatgatgaaaggatgaatttctttcaaaattttggattcatacggttatacatctatagtagtagtagt |
2631936 |
T |
|
| Q |
101 |
nnnnaatatattaatttttcaactcgcactacacctgtattgtacgtataaaatagatagatcgaagttacattgagtatacgtaccatcgatgttaatg |
200 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| ||||| |
|
|
| T |
2631935 |
a---aatatattaatttttcaaatcgcactacacctgtattgtacgtataaaatagatagatcgatgttacattgagtatacgtaccatcgatggtaatg |
2631839 |
T |
|
| Q |
201 |
gagtcgttgtcctatctctagttggggcattgctaactctaacttataagatagacatctggcttggcttgatttaaattaaagatcatgtcccaactct |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2631838 |
gagtcgttgtcctatctctagttggggcattgctaactctaacttataagatagacatctggcttggcttgatttaaattaaagatcatgtcccaactct |
2631739 |
T |
|
| Q |
301 |
atctctttttctttttgacattcatctgcatat |
333 |
Q |
| |
|
||||||||||||||||||||||||| ||||||| |
|
|
| T |
2631738 |
atctctttttctttttgacattcatgtgcatat |
2631706 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University