View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14745_low_13 (Length: 288)
Name: NF14745_low_13
Description: NF14745
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14745_low_13 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 238; Significance: 1e-132; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 238; E-Value: 1e-132
Query Start/End: Original strand, 18 - 288
Target Start/End: Complemental strand, 40416026 - 40415756
Alignment:
| Q |
18 |
taattaagattgtttcaaccagaattcgaacttaatttctctggaacaattcatcccaactatctttgatggtctcannnnnnnatataaaatcttaaat |
117 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
40416026 |
taattaagattgtttcaaccagaattcaaacttaatttctctggaacaattcatcccaactatctttgatggtctcatttttttatataaaatcttaaat |
40415927 |
T |
 |
| Q |
118 |
ttcatgatataatgttgcaggtaattagcatggagtggggaaacttcaattcctctcatgttcctctaacatcgtttgacactattttagatgctgaaag |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40415926 |
ttcatgatataatgttgcaggtaattagcatggagtggggaaacttcaattcctctcatgttcctctaacatcgtttgacactattttagatgctgaaag |
40415827 |
T |
 |
| Q |
218 |
ctcaaatcctggaagtggggtatattataaactaaattcaatattgataatttatcttgatatctagaatt |
288 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
40415826 |
ctcaaattctggaagtggggtatattataaactaaattcactattgataatttatcttgatatctagaatt |
40415756 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University