View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14745_low_19 (Length: 243)
Name: NF14745_low_19
Description: NF14745
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14745_low_19 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 84; Significance: 5e-40; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 84; E-Value: 5e-40
Query Start/End: Original strand, 141 - 228
Target Start/End: Original strand, 14488537 - 14488624
Alignment:
| Q |
141 |
gaagattccaagatcttgaaaccaactttcttgcacataactcaaaaacttctatttatcaagggaaaagttgtgatatgcagtaatt |
228 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14488537 |
gaagatttcaagatcttgaaaccaactttcttgcacataactcaaaaacttctatttatcaagggaaaagttgtgatatgcagtaatt |
14488624 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 82; E-Value: 8e-39
Query Start/End: Original strand, 1 - 86
Target Start/End: Original strand, 14488411 - 14488496
Alignment:
| Q |
1 |
cataataattatgagttttgacattattatatttttatagattttcctctttccctttacaaaccttttctccgattgtgatatgg |
86 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14488411 |
cataataattatgagttttgacattattatatttttatagattttcctttttccctttacaaaccttttctccgattgtgatatgg |
14488496 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University