View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14746_low_17 (Length: 208)
Name: NF14746_low_17
Description: NF14746
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14746_low_17 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 127; Significance: 9e-66; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 127; E-Value: 9e-66
Query Start/End: Original strand, 14 - 189
Target Start/End: Original strand, 48372683 - 48372858
Alignment:
| Q |
14 |
tagcaaagggatcaagaagaagcacnnnnnnntgaaaggtcgcttttttagattggtttgcggatgaaacatgttttagtcacttatgtgattttgatct |
113 |
Q |
| |
|
|||| |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48372683 |
tagccaagggatcaagaagaagcacagaaaaatgaaaggtcgcttttttagattggtttgcggatgaaacatgttttagtcacttatgtgattttgatct |
48372782 |
T |
 |
| Q |
114 |
ctgtctttgaaattgttactatccaatnnnnnnnntcaataaactatacacacattaataattgatctctgtcttt |
189 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48372783 |
ctgtctttgaaattgttactatccaataaaagaaatcaataaactatacacacattaataattgatctctgtcttt |
48372858 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University