View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14747_low_11 (Length: 320)
Name: NF14747_low_11
Description: NF14747
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14747_low_11 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 255; Significance: 1e-142; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 255; E-Value: 1e-142
Query Start/End: Original strand, 18 - 294
Target Start/End: Complemental strand, 26595208 - 26594935
Alignment:
| Q |
18 |
tatatgatgatatttttggatatggttcgagattctttattacatcaggagtagcagacgacaaagagcactcactgcataattgtctcattgtgctacc |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26595208 |
tatatgatgatatttttggatatggttcgagattctttattacatcaggagtagcagacgacaaagagcactcactgcataattgtctcattgtgctacc |
26595109 |
T |
 |
| Q |
118 |
aaacatcaacgaaaggaaataacaactcttacaaaaccattatcaccaacaaaaaagttaagtgtgaatttgtgctccatcgacatgatctttaccaaat |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26595108 |
aaacatcaacgaaaggaaataacaactcttacaaaaccattat---caacaaaaaagttaagtgtgaatttgtgctccatcgacatgatctttaccaaat |
26595012 |
T |
 |
| Q |
218 |
ctattacggaagacaaaattgtttttacggtatcttaaccttaagagattgtaatttgactttcatgacatgagatg |
294 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
26595011 |
ctattgcggaagacaaaattgtttttacggtatcttaaccttaacagattgtaatttgactttcatgacatgagatg |
26594935 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 36 - 96
Target Start/End: Complemental strand, 26608738 - 26608678
Alignment:
| Q |
36 |
gatatggttcgagattctttattacatcaggagtagcagacgacaaagagcactcactgca |
96 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||| |||||||||||||||||||||| |
|
|
| T |
26608738 |
gatatggttcgagattctttattacatcagacctagcacacgacaaagagcactcactgca |
26608678 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 164 - 217
Target Start/End: Complemental strand, 26608614 - 26608561
Alignment:
| Q |
164 |
caacaaaaaagttaagtgtgaatttgtgctccatcgacatgatctttaccaaat |
217 |
Q |
| |
|
|||| ||||||| ||||||||||||||| | |||||||||||||||||||||| |
|
|
| T |
26608614 |
caaccaaaaagtgaagtgtgaatttgtgtccaatcgacatgatctttaccaaat |
26608561 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University