View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14747_low_13 (Length: 309)

Name: NF14747_low_13
Description: NF14747
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14747_low_13
NF14747_low_13
[»] chr5 (1 HSPs)
chr5 (139-298)||(9617526-9617684)


Alignment Details
Target: chr5 (Bit Score: 136; Significance: 6e-71; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 136; E-Value: 6e-71
Query Start/End: Original strand, 139 - 298
Target Start/End: Original strand, 9617526 - 9617684
Alignment:
139 gatctccgtctaacgttagtattaggcttcccccctttgccgcctaccattttctcctcctgcgaaacacttgtgattctccatttgtggagtttacgtg 238  Q
    |||||||||||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||    
9617526 gatctccgtctagcgttagtattaggcttctcccctttgccgcctaccattttctcctcctgcgaaacacttgtgattctccattt-tggagtttacgtg 9617624  T
239 tagccactatgactcattgctctgttcatcttcctttacttaagaccctggatctgatga 298  Q
    ||||||||||||||||||| ||||||||||||||||||||||||||||||||| ||||||    
9617625 tagccactatgactcattgttctgttcatcttcctttacttaagaccctggatatgatga 9617684  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University