View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14748_low_5 (Length: 307)
Name: NF14748_low_5
Description: NF14748
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14748_low_5 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 271; Significance: 1e-151; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 271; E-Value: 1e-151
Query Start/End: Original strand, 13 - 291
Target Start/End: Complemental strand, 32706098 - 32705820
Alignment:
| Q |
13 |
attattcaaagttgagtgttttcttcatgcataattcaatttgcactcaactatgtaaaatacttcaatttggaactcaactatggaaagttgaaaattg |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32706098 |
attattcaaagttgagtgttttcttcatgcataattcaatttgcactcaactatgtaaaatacttcaatttggaactcaactatggaaagttgaaaattg |
32705999 |
T |
 |
| Q |
113 |
agaagaatactactggacaacgtattggagagaggtcttcttttcgatgtcctgaattctgagatattagttgagaacctcatttcctctcatttctcaa |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32705998 |
agaagaatactactggacaacgtattggagagaggtcttcttttcgatgtcctgaattctgatatattagttgagaacctcatttcctctcatttctcaa |
32705899 |
T |
 |
| Q |
213 |
tgcagttatattgatatgtttgagaataacccagatatggatcacaatgagtccctggggcaattcctcaagtcaaggg |
291 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
32705898 |
tgcagttatattgatatgtttgagaataacccagatatggatcacaatgagtctctggggcaattcctcaagtcaaggg |
32705820 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University