View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14748_low_8 (Length: 234)
Name: NF14748_low_8
Description: NF14748
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14748_low_8 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 153; Significance: 3e-81; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 153; E-Value: 3e-81
Query Start/End: Original strand, 1 - 218
Target Start/End: Original strand, 4776284 - 4776485
Alignment:
| Q |
1 |
atgggagtagacacaggtttgcagtcgcccatgtttgctcgaaggagaatatctcttatgtaatgatcttgtgtaagaaataagccagtcctggttggta |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4776284 |
atgggagtagacacaggtttgcagtcgcccatgtttgctcgaaggagaatatctcttatgtgatgatcttgtgtaagaaataagccagtcctggttggta |
4776383 |
T |
|
| Q |
101 |
taatttcgactccaagaaagtggcttggctggcccaaatctttgagggaaaattgatctgcaagtgcctctttaaattgatctagaaaactagaatcgtt |
200 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
4776384 |
taatttcgactccaagaaagtgg----------------ctttgagggaaaattgatctgcaagtgcctctttaaattgatctggaaaactagaatcgtt |
4776467 |
T |
|
| Q |
201 |
gctgcatagtaataaatc |
218 |
Q |
| |
|
|| ||||||||||||||| |
|
|
| T |
4776468 |
gccgcatagtaataaatc |
4776485 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University