View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14749_high_11 (Length: 263)
Name: NF14749_high_11
Description: NF14749
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14749_high_11 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 218; Significance: 1e-120; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 218; E-Value: 1e-120
Query Start/End: Original strand, 18 - 263
Target Start/End: Complemental strand, 22104509 - 22104264
Alignment:
| Q |
18 |
atagcatcaccttcgacacctggatgcaaaacaacattgtctccacccaaagaaataagcttgaaatccacaaactccgcatcaacgaaagcttgttgaa |
117 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||| |||||||||||||||||||||||||||||||| || ||||||||||||||||||||| |
|
|
| T |
22104509 |
atagcatcaccttcgacacccggatgcaaaacaacattgtcttcacccaaagaaataagcttgaaatccacaaaccccacatcaacgaaagcttgttgaa |
22104410 |
T |
 |
| Q |
118 |
caatagacaagcaaaagtcattttttagtcttgctaaaatactcttggaggcccaagtaatgtcatctgtgaacggcatgaatttacacatcactttctt |
217 |
Q |
| |
|
||||| ||||||||||||||||||| ||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22104409 |
caatatacaagcaaaagtcatttttaagtcttgctaaaatactcttggatgcccaagtaatgtcatctgtgaacggcatgaatttacacatcactttctt |
22104310 |
T |
 |
| Q |
218 |
ttcaacatcagcgccattaactagctccttcaccatcactttcttt |
263 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22104309 |
ttcaacatcagcgccattaactagctccttcaccatcactttcttt |
22104264 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University