View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14749_low_10 (Length: 312)
Name: NF14749_low_10
Description: NF14749
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14749_low_10 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 169; Significance: 1e-90; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 169; E-Value: 1e-90
Query Start/End: Original strand, 117 - 293
Target Start/End: Original strand, 54828234 - 54828410
Alignment:
| Q |
117 |
gtcgtttaatttgtgtctatgataattactactcttatgcattgtactgatgattaattaataactagttggcattacactttatgttatgtataaactg |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
54828234 |
gtcgtttaatttgtgtctatgataattactactcttatgcattgtactaatgattaattaataactagttggcattacactttatgttatgtaaaaactg |
54828333 |
T |
 |
| Q |
217 |
tgacttcaccatcttatgatttatcgctcttaccattattgtttgtgggtctgcgtattatatactttgctccaggt |
293 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54828334 |
tgacttcaccatcttatgatttatcgctcttaccattattgtttgtgggtctgcgtattatatactttgctccaggt |
54828410 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 12 - 80
Target Start/End: Original strand, 54828127 - 54828195
Alignment:
| Q |
12 |
tgagatgaagggtatacttgataagatcaaagaaaaattgcctggccaccatcacagccactgaacaac |
80 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54828127 |
tgagaagaagggtatacttgataagatcaaagaaaaattgcctggccaccatcacagccactgaacaac |
54828195 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University