View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14749_low_14 (Length: 281)
Name: NF14749_low_14
Description: NF14749
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14749_low_14 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 195; Significance: 1e-106; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 18 - 265
Target Start/End: Complemental strand, 48849416 - 48849173
Alignment:
| Q |
18 |
atgaaaaattattgctagtgtaattgacatgacaattaatgattgcaaaatatcaattaatgttcaacattcatcttccaaattcaataatcgcgttaat |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48849416 |
atgaaaaattattgctagtgtaattgacataacaattagtgattgcaaaatatcaattaatgttcaacattcatcttccaaattcaataatcgcgttaat |
48849317 |
T |
|
| Q |
118 |
tgacattcaaaaccctatccaatttgttattacaagcataccatcataatgtgaccatttcaacattatagaaaggctaatatcattgctttggaagaag |
217 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
48849316 |
tgacattcaaaaccctatccaacttgttattacaagcataccatcataatgtgaccatttcaacattatagaaaggctaatatcattgctttggacaaa- |
48849218 |
T |
|
| Q |
218 |
nnnnnnntgcacgccctcatagctattatgtaagaagattgctcttta |
265 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
48849217 |
---aaaatgcacgccctcatggctattatgtaagaagattgctcttta |
48849173 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University