View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14749_low_20 (Length: 232)
Name: NF14749_low_20
Description: NF14749
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14749_low_20 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 207; Significance: 1e-113; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 1 - 218
Target Start/End: Original strand, 32932630 - 32932848
Alignment:
| Q |
1 |
tgcaaggatatttaggtggttggttatccaatttgaagtgagaaaatttatgtaaaccacccttaacccgacacatttcaagtcaaccaaaaaagggcac |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32932630 |
tgcaaggatatttaggtggttggttatccaatttgaagtgagaaaatttatgtaaaccacccttaacccgacacatttcaagtcaaccaaaaaagggcac |
32932729 |
T |
|
| Q |
101 |
gtcgaaaaatggaacaatgtcctagccacggccaccaatagccataacttgcca-tagaacataagctcttgtacattaaagttcatgcaggattccaga |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
32932730 |
gtcgaaaaatggaacaatgtcctagccacggccaccaatagccataacttgccagtagaacataaggtcttgtacattaaagttcatgcaggattccaga |
32932829 |
T |
|
| Q |
200 |
tggaattggatgctcaaac |
218 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
32932830 |
tggaattggatgctcaaac |
32932848 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 67; E-Value: 6e-30
Query Start/End: Original strand, 1 - 154
Target Start/End: Original strand, 32921354 - 32921498
Alignment:
| Q |
1 |
tgcaaggatatttaggtggttggttatccaatttgaagtgagaaaatttatgtaaaccacccttaacccgacacatttcaagtcaaccaaaaaagggcac |
100 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||| |||||||| ||| ||||| ||| ||||||||| |||||||||||||| | |||| |
|
|
| T |
32921354 |
tgcaaggatattttggtggttggttatccaatttgaattgagaaaa---------accgcccttgaccggacacatttgaagtcaaccaaaaa-gagcac |
32921443 |
T |
|
| Q |
101 |
gtcgaaaaatggaacaatgtcctagccacggccaccaat-agccataacttgcca |
154 |
Q |
| |
|
||||||||||| |||||||||||||||| |||||||| | ||||||||||||||| |
|
|
| T |
32921444 |
gtcgaaaaatgcaacaatgtcctagccatggccaccagtaagccataacttgcca |
32921498 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University