View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1474_high_7 (Length: 239)
Name: NF1474_high_7
Description: NF1474
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1474_high_7 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 170; Significance: 2e-91; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 170; E-Value: 2e-91
Query Start/End: Original strand, 39 - 224
Target Start/End: Complemental strand, 33117137 - 33116952
Alignment:
| Q |
39 |
cataaactaactcaaactgactcaacccttctgagaggtgattctcttattccaaaacttgaattgcagagtcctttgttgaagcatcttctccacttcc |
138 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33117137 |
cataaactaactcaaactgactcaacccttctgagaggcgattctcttattccaaaacttgaattgcagagtcctttgttgaagcatcttctccacttcc |
33117038 |
T |
|
| Q |
139 |
tcaattggaacacctttggtttcaggtacgaaaacgaggacaaagaaaattgctatgacagcaacaattccaaacaacatgaatgt |
224 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||| || ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33117037 |
tcaattggaacacctttggtttctggtacgaaaacgaggacaaaggaacttgctatgacagcaacaattccaaacaacatgaatgt |
33116952 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University