View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1474_high_9 (Length: 236)
Name: NF1474_high_9
Description: NF1474
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1474_high_9 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 115; Significance: 2e-58; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 115; E-Value: 2e-58
Query Start/End: Original strand, 1 - 119
Target Start/End: Original strand, 12724156 - 12724274
Alignment:
| Q |
1 |
tgttcaagatgctttgtgtttgtgccaccttgttatgtgtcctgaaatatttttctctccatttgccttgtggggctttccaactaatccttatggatta |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12724156 |
tgttcaagatgctttgtgtttgtgccaccttgttatgtgtcctgaaatatttttctctccatttgccttgtggggctttccaactaatccttatggatta |
12724255 |
T |
 |
| Q |
101 |
tcaaatgatcagtcacatc |
119 |
Q |
| |
|
|||||||||| |||||||| |
|
|
| T |
12724256 |
tcaaatgatctgtcacatc |
12724274 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 148 - 221
Target Start/End: Original strand, 12724303 - 12724376
Alignment:
| Q |
148 |
acatactaaaattggtatcttatcttaataaactaattagtaaagaaaaattaaaaacttatggataaatcttt |
221 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
12724303 |
acatactaaaattggtatcttatcttaataaactaattagtaaagaaaaattaaaaacttatggataattcttt |
12724376 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University