View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1474_low_3 (Length: 323)
Name: NF1474_low_3
Description: NF1474
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1474_low_3 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 122; Significance: 1e-62; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 122; E-Value: 1e-62
Query Start/End: Original strand, 1 - 122
Target Start/End: Complemental strand, 12724173 - 12724052
Alignment:
| Q |
1 |
cacaaagcatcttgaacaaagaatataattcttagcaatagttttttctttatttctattcttacacaaccaactaaactttctaaatatactaaaaata |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12724173 |
cacaaagcatcttgaacaaagaatataattcttagcaatagttttttctttatttctattcttacacaaccaactaaactttctaaatatactaaaaata |
12724074 |
T |
 |
| Q |
101 |
aggtaagattatactcgtgatc |
122 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
12724073 |
aggtaagattatactcgtgatc |
12724052 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 76; E-Value: 4e-35
Query Start/End: Original strand, 237 - 320
Target Start/End: Complemental strand, 12723937 - 12723854
Alignment:
| Q |
237 |
cttgtgagttctcaatctttaaatctatgatttactttcttgtgggttctcaatgttcaaatttcaattgcgtgatagaataat |
320 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |||||| |
|
|
| T |
12723937 |
cttgtgagttctcaatctttaaatctatgatttactttcttgtgggctctcaatgttcaaatttcaattgcgtgatataataat |
12723854 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University