View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14750_high_3 (Length: 395)
Name: NF14750_high_3
Description: NF14750
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14750_high_3 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 306; Significance: 1e-172; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 306; E-Value: 1e-172
Query Start/End: Original strand, 57 - 378
Target Start/End: Complemental strand, 5697715 - 5697394
Alignment:
| Q |
57 |
acacgttgcaacaatgactaaatctatgaagaacaaaatgaatgcaacaaataattcctaaatgagcaaataatttttgaagttctgcccatcagaatta |
156 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5697715 |
acacattgcaacaatgactaaatctatgaagaacaaaatgaatgcaacaaataattcctaaatgagcaaataatttttgaagttctgcccatcagaatta |
5697616 |
T |
 |
| Q |
157 |
tcccttagaggcaatgtttcgtggtgagatttgcaactggaaaacatattataaactccttgggatagcaaaaatcgttgagtgggttgaaataggggaa |
256 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
5697615 |
tcccttagaggcaatgtttcgtggggagatttgcaactggaaaacatattataaactccttgggatagcaaaaatcgttgagtgggttgaattaggggaa |
5697516 |
T |
 |
| Q |
257 |
atgagagaaattatggattgctcttgataaacaattgaggataatttattggttaatttttgtaactctcttgttcttgatataaaaggttagggtggaa |
356 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5697515 |
atgagagaaattatggattgctcttggtaaacaattgaggataatttattggttaatttttgtaactctcttgttcttgatataaaaggttagggtggaa |
5697416 |
T |
 |
| Q |
357 |
attagggtttgcttatgttgat |
378 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
5697415 |
attagggtttgcttatgttgat |
5697394 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University