View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14750_low_10 (Length: 260)
Name: NF14750_low_10
Description: NF14750
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14750_low_10 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 203; Significance: 1e-111; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 20 - 242
Target Start/End: Complemental strand, 42516724 - 42516502
Alignment:
| Q |
20 |
aagcatattctatgaatcaactaataaaaatgattgatatacaaattattgtgattaattatttgcaataatagagaggctgatttatggaatagtgatt |
119 |
Q |
| |
|
|||||||||||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42516724 |
aagcatattctatgaatcaactaaaataaatgattgatatacaaattattgtgattaattatttgcaataatagagaggctgatttatggaatagtgatt |
42516625 |
T |
 |
| Q |
120 |
gctcctttacaggttaagggtgaggaatgtcagaataattgagcaacaagaaatatcaaacaccctctttgacactcattttcattgcaagacaagtctc |
219 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||| ||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42516624 |
gctcctttacaggtcaagggtgaggaatgtcagaataatcgagcaacaagaaataacaaacaccctctttgacactcattttcattgcaagacaagtctc |
42516525 |
T |
 |
| Q |
220 |
aatgccagtgtcgaaactacctt |
242 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
42516524 |
aatgccagtgtcgaaactacctt |
42516502 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University