View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14750_low_12 (Length: 250)
Name: NF14750_low_12
Description: NF14750
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14750_low_12 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 81; Significance: 3e-38; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 81; E-Value: 3e-38
Query Start/End: Original strand, 151 - 231
Target Start/End: Complemental strand, 28870336 - 28870256
Alignment:
| Q |
151 |
gtaatcataaaaatttcatcttgtgaatttcattcatcagtttctgtgttttttcataatgtgattgtttaacttggtgtt |
231 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28870336 |
gtaatcataaaaatttcatcttgtgaatttcattcatcagtttctgtgttttttcataatgtgattgtttaacttggtgtt |
28870256 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 18 - 92
Target Start/End: Complemental strand, 28870469 - 28870395
Alignment:
| Q |
18 |
aaaaagacttggttagattggtattttcatggtcacttcaagatatactcaacgatgatcttttgcgtgacaagg |
92 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| | |||||||| |
|
|
| T |
28870469 |
aaaaagacttggttagattggtgttttcatggtcacttcaagatatactcaacgatgatctttttcatgacaagg |
28870395 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University