View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14750_low_13 (Length: 228)
Name: NF14750_low_13
Description: NF14750
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14750_low_13 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 177; Significance: 1e-95; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 177; E-Value: 1e-95
Query Start/End: Original strand, 19 - 215
Target Start/End: Original strand, 12628826 - 12629022
Alignment:
| Q |
19 |
accttacgcagttatacctccgcgaggttctcttgtgtaattgtttatcctcagttaaactttcaactcagttggtgattttaaattcgacctgatacaa |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
12628826 |
accttacgcagttatacctccgcgaggttctcttgtgtaattgtttatcctcagttaaactttcaactcagatggtgattttaaattcgacctgatacaa |
12628925 |
T |
|
| Q |
119 |
ttctattagtgtattgtattcatgttccttaacccatgcaaattttaagatccccggtgttaggtgttttagtttcttttggttgataatattcttg |
215 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||| |||||||||||||||||||||||| |||||||||||| |||||||| |
|
|
| T |
12628926 |
ttctattagtgtattgtattcatgttctttaacccatgcaaattttaagagccccggtgttaggtgttttagttttttttggttgatactattcttg |
12629022 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 111; Significance: 4e-56; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 111; E-Value: 4e-56
Query Start/End: Original strand, 23 - 173
Target Start/End: Complemental strand, 37963845 - 37963695
Alignment:
| Q |
23 |
tacgcagttatacctccgcgaggttctcttgtgtaattgtttatcctcagttaaactttcaactcagttggtgattttaaattcgacctgatacaattct |
122 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||| |||| ||| |||||||||||||||||||||||||||| |||||||| ||| ||||||||| |
|
|
| T |
37963845 |
tacgcagttataccttcgcgaggttctcttgtgtaattgcttatactcggttaaactttcaactcagttggtgatttcaaattcgaactggtacaattct |
37963746 |
T |
|
| Q |
123 |
attagtgtattgtattcatgttccttaacccatgcaaattttaagatcccc |
173 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||| ||| |||| |
|
|
| T |
37963745 |
attagtgtattgtattcatgttctttaacccatgcaaatttttagagcccc |
37963695 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University