View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14750_low_14 (Length: 216)
Name: NF14750_low_14
Description: NF14750
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14750_low_14 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 135; Significance: 2e-70; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 135; E-Value: 2e-70
Query Start/End: Original strand, 49 - 199
Target Start/End: Complemental strand, 41670848 - 41670698
Alignment:
| Q |
49 |
attagatttctatttttcattagaagtacagaaccagtagatttcagggcaaagtaaaattgcaaagagaattgagggcaaaataaaatttcattaattg |
148 |
Q |
| |
|
||||| |||||||||||||||||||||||||||| |||||||| |||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
41670848 |
attagttttctatttttcattagaagtacagaactagtagattgcagggcaaagtaaaattgcaaagagaattgagggaaaaataaaatttcattaattg |
41670749 |
T |
|
| Q |
149 |
tcacatgaaaacgagtagatccaaaataaactttacataaaccctaattat |
199 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41670748 |
tcacatgaaaacgagtagatccaaaataaactttacataaaccctaattat |
41670698 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 12 - 57
Target Start/End: Complemental strand, 41670909 - 41670864
Alignment:
| Q |
12 |
agagaagaacaaacacaacaactatgagtttcatagcattagattt |
57 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41670909 |
agagaagaacaaacacaacaactatgagtttcatagcattagattt |
41670864 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University