View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14750_low_15 (Length: 208)
Name: NF14750_low_15
Description: NF14750
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14750_low_15 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 128; Significance: 2e-66; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 128; E-Value: 2e-66
Query Start/End: Original strand, 19 - 173
Target Start/End: Complemental strand, 30741260 - 30741108
Alignment:
| Q |
19 |
tataagtgggaagttgtgttatttaatcatgaaattaaaagcaaaaatatgttaaattaaaatagtatggaaggagtttatgtggctgtgtttgaaattt |
118 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |||||| |
|
|
| T |
30741260 |
tataagtaggaagttgtgttatttaatcatgaaattaaaagcaaaaatatgttaaattaaaataatatggaaggagtttatgtggctgtgtttaaaattt |
30741161 |
T |
|
| Q |
119 |
tgaagctttgagatgatggaaggagttaaaagacacaaccacatcaaaatttcaa |
173 |
Q |
| |
|
||||| |||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
30741160 |
tgaagatttgagatgatggaaggagttaaa--acacaaccacatcaaaatttcaa |
30741108 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University