View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14750_low_8 (Length: 268)
Name: NF14750_low_8
Description: NF14750
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14750_low_8 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 231; Significance: 1e-127; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 231; E-Value: 1e-127
Query Start/End: Original strand, 17 - 251
Target Start/End: Original strand, 54350442 - 54350676
Alignment:
| Q |
17 |
gaacaaaaatatgagctgaaacgagagatacgtgacatgacttgtcggcgttagtgcatgtggtggtggtgaccatctcacagaaaaaccacaacacaag |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54350442 |
gaacaaaaatatgagctgaaacgagagatacgtgacatgacttgtcggcgttagtgcatgtggtggtggtgaccatctcacagaaaaaccacaacacaag |
54350541 |
T |
 |
| Q |
117 |
gtcgcatgtgccaacgttctagtaatacaatactgtttttgtcgaatacaacttatgctaaacattgtatctgagcaacgagtgtcccctttacggcctt |
216 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54350542 |
gtcgcatgtgccaacgttctagtaatacaatactgtttttgtcgaatacaacttatgttaaacattgtatctgagcaacgagtgtcccctttacggcctt |
54350641 |
T |
 |
| Q |
217 |
cacccattcaataaaataattaggatgttatatgt |
251 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
54350642 |
cacccattcaataaaataattaggatgttatatgt |
54350676 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University