View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14751_high_17 (Length: 306)
Name: NF14751_high_17
Description: NF14751
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14751_high_17 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 183; Significance: 5e-99; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 183; E-Value: 5e-99
Query Start/End: Original strand, 16 - 230
Target Start/End: Original strand, 44732882 - 44733091
Alignment:
| Q |
16 |
atgaacagtgaacacaaaactatcaactcgcttctactgattaatcacttttcattcaaaacttaaacaacctgcaagaagggtaaagctaagtggcact |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| ||||||||||||||||||| |||||| ||||||| |
|
|
| T |
44732882 |
atgaacagtgaacacaaaactatcaactcgcttctactgattaatcacttttcattaaaaagttaaacaacctgcaagaagagtaaag-----tggcact |
44732976 |
T |
|
| Q |
116 |
atttacatgataaattcaaaataagagagactttgatcaccctaaacaaccaagaagaacttggtttgtgtctaaaattagaaaggcatgtcattagcct |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44732977 |
atttacatgataaattcaaaataagagagactttgatcaccctaaacaaccaagaagaacttggtttgtgtctaaaattagaaaggcatgtcattagcct |
44733076 |
T |
|
| Q |
216 |
tacaaattaagctac |
230 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
44733077 |
tacaaattaagctac |
44733091 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 258 - 306
Target Start/End: Original strand, 44733119 - 44733167
Alignment:
| Q |
258 |
tcttggagatattttttccactctttcatttgctcaatttattgatgct |
306 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44733119 |
tcttggagatattttttccactctttcatttgctcaatttattgatgct |
44733167 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University