View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14751_high_19 (Length: 258)
Name: NF14751_high_19
Description: NF14751
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14751_high_19 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 243; Significance: 1e-135; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 243; E-Value: 1e-135
Query Start/End: Original strand, 1 - 258
Target Start/End: Original strand, 52477428 - 52477683
Alignment:
| Q |
1 |
aactatttgtatggaagacaacttcattgtttagttttgaatatagtgaaaaactgaaagtgttttctgaaatcaaagtttgcaagatcagagaagtgtc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52477428 |
aactatttgtatggaagacaacttcattgtttagtttttaatatagtgaaaaactgaaagtgttttctgaaatcaaagtttgcaagatcagagaagtgtc |
52477527 |
T |
|
| Q |
101 |
ttgcgttttgttttgaagatgcaattgtgactagaagtgataaggaacataagttccaaggacaaaaccagcatgagagtcagagtcaaaaataaatcaa |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
52477528 |
ttgcgttttgttttgaagatgcaattgtgactagaagtgataaggaacataagttccaaggacaaaaccagcatgagagtc--agtcaaaaataaatcaa |
52477625 |
T |
|
| Q |
201 |
gtgaaataacggatttggttaccggaggcggcgaagtcggacaaattcatagacacct |
258 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52477626 |
gtgaaataacggatttggttaccggaggcggcgaagtcggacaaattcatagacacct |
52477683 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University