View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14751_low_25 (Length: 253)
Name: NF14751_low_25
Description: NF14751
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14751_low_25 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 149; Significance: 8e-79; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 149; E-Value: 8e-79
Query Start/End: Original strand, 16 - 248
Target Start/End: Original strand, 29456697 - 29456929
Alignment:
| Q |
16 |
tgaacatggttttttaacttcnnnnnnngtaaggggtttttaaacaaat-----ggcttactatggcactttgtatttatgatttgaaaacataatgcta |
110 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29456697 |
tgaacatggttttttaacttctttttttgtaaggggtttttaaacaaattaataggcttactatggcactttgtatttatgatttgaaaacataatgcta |
29456796 |
T |
|
| Q |
111 |
gttatttataatttggttaaacatttaaaagggatttccataggttattacaaacccatcatatatttctcatttgaaagagnnnnnnnnttggcaaggt |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||||| ||||||||||||||||||||||||||| | |||||||||| |
|
|
| T |
29456797 |
gttatttataatttggttaaacatttaaaa-ggatttccataggttattacgaacccatcatatatttctcatttgaaaaa----aaaaattggcaaggt |
29456891 |
T |
|
| Q |
211 |
gaggtgtcagaggtgctttcaagaagcacaggtaagac |
248 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29456892 |
gaggtgtcagaggtgctttcaagaagcacaggtaagac |
29456929 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 80; E-Value: 1e-37
Query Start/End: Original strand, 80 - 253
Target Start/End: Original strand, 29448816 - 29448983
Alignment:
| Q |
80 |
tttgtatttatgatttgaaaacataatgctagttatttataatttggttaaacatttaaaagggatttccataggttattacaaacccatcatatatttc |
179 |
Q |
| |
|
|||||||||||||||||||| |||||| ||||||| ||||||||||| ||||||||||| ||| |||||||||||||||||||||||| ||||||||||| |
|
|
| T |
29448816 |
tttgtatttatgatttgaaa-cataattctagttacttataatttggctaaacatttaacaggtatttccataggttattacaaacccgtcatatatttc |
29448914 |
T |
|
| Q |
180 |
tcatttgaaagagnnnnnnnnttggcaaggtgaggtgtcagaggtgctttcaagaagcacaggtaagacttttt |
253 |
Q |
| |
|
|||||| | | || ||||||||||||||||||||||||||||||||||| | ||||||| |||| |
|
|
| T |
29448915 |
tcatttcaga-----acaattttcgcaaggtgaggtgtcagaggtgctttcaagaagcaaatgtaagacctttt |
29448983 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University