View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14751_low_28 (Length: 235)
Name: NF14751_low_28
Description: NF14751
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14751_low_28 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 113; Significance: 2e-57; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 113; E-Value: 2e-57
Query Start/End: Original strand, 16 - 220
Target Start/End: Original strand, 26949120 - 26949324
Alignment:
| Q |
16 |
atatctggattgatgaataattctacnnnnnnnnagggat-aattcttggccaataggtggaatattcataattttcgctttcgtgcacttttgctatgt |
114 |
Q |
| |
|
|||||||||||||||||||||||||| |||||| ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
26949120 |
atatctggattgatgaataattctacttttttt-agggatgaattcttggccaataggtggaatattcataattttcgctttcgtgtacttttgctatgt |
26949218 |
T |
 |
| Q |
115 |
agggttgatttatgnnnnnnnaccacacactcatacactttctattcaattattttctannnnnnnnnaatgtatgtgctataaatgatattgatagtat |
214 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||||||||||||||| |
|
|
| T |
26949219 |
agggttgatttatgccccccgaccacacactcatacactttctattcaattattttctatttttttttaatgtgtgtgctataaatgatattgatagtat |
26949318 |
T |
 |
| Q |
215 |
ctttag |
220 |
Q |
| |
|
|||||| |
|
|
| T |
26949319 |
ctttag |
26949324 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University