View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14752_high_11 (Length: 322)
Name: NF14752_high_11
Description: NF14752
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14752_high_11 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 234; Significance: 1e-129; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 234; E-Value: 1e-129
Query Start/End: Original strand, 18 - 304
Target Start/End: Original strand, 33694793 - 33695083
Alignment:
| Q |
18 |
acgtttgtgcaatgatcgatcgttcaattaaattgtttatcctccaaacctcttttcgaacctcttcnnnnnnngtttaaactaaaccgaagtagtgtca |
117 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
33694793 |
acgtttatgcaatgatcgatcgttcaattaaattgtttatcctccaaacctcttttcgaacctcttctttttttgtttaaactaaaccgaagtagtgtca |
33694892 |
T |
|
| Q |
118 |
atttttatgattggctattgcggagaaaaactagtaagacttttcaagaatagtgacatgattaatgttgatgttggcaaacgatatcattttctattaa |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
33694893 |
atttttatgattggctattgcggagaaaaactagtaagacttttcaagaatagtgacatgattaatgttgatgttggc-aacgatatcattttctattaa |
33694991 |
T |
|
| Q |
218 |
tacacatacctactcatca----catggagcaatagattaatggaacatttcatctaaattcgtagaatttatttttg-aaagggttagggg |
304 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
33694992 |
tacacatacctactcatcacatgcatggagcaatagattaatggaacatttcatctaaattcgtagaatttatttttgaaaagggttagggg |
33695083 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University