View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14752_high_20 (Length: 243)
Name: NF14752_high_20
Description: NF14752
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14752_high_20 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 199; Significance: 1e-108; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 1 - 227
Target Start/End: Complemental strand, 4878631 - 4878405
Alignment:
| Q |
1 |
agagagaagaatcccttcatttttcttaaaaaataaaattaagatatttggtgccagtttaattcatcaatatataaagaatcaaagaataatttggggt |
100 |
Q |
| |
|
||||| || |||||||||||||||||||||||||||||||||| ||||||||| || ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4878631 |
agagaaaaaaatcccttcatttttcttaaaaaataaaattaagctatttggtgacaatttaattcatcaatatataaagaatcaaagaataatttggggt |
4878532 |
T |
|
| Q |
101 |
gcactaacaaattgttctttcactccctctcttgtcccttcccacaccaaataaaatgacactattaggaacacttgtctaggattcaatttctttattc |
200 |
Q |
| |
|
||| ||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4878531 |
gcattaacaaattgttctttcactcactctcttgtcccttcccacaccaaataaaatgacactattaggaacacttgtctaggattcaatttctttattc |
4878432 |
T |
|
| Q |
201 |
attccatccattatttatgggtagttt |
227 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
4878431 |
attccatccattatttatgggtagttt |
4878405 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University