View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14752_high_6 (Length: 432)

Name: NF14752_high_6
Description: NF14752
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14752_high_6
NF14752_high_6
[»] chr4 (1 HSPs)
chr4 (18-323)||(24159284-24159589)


Alignment Details
Target: chr4 (Bit Score: 302; Significance: 1e-170; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 302; E-Value: 1e-170
Query Start/End: Original strand, 18 - 323
Target Start/End: Complemental strand, 24159589 - 24159284
Alignment:
18 gttccggagttgcttcggaggagagaaagtgtgtttcgagaggcacggttaacgtcgaagagagtacggtgaggctccggggagatgctgaaagcggaag 117  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
24159589 gttccggagttgcttcggaggagagaaagtgtgtttcgagaggcacggttaacgtcgaagagagtacggtgaggctccggggagatgctgaaagcggaag 24159490  T
118 cgagctccggtgggatcaacgccatggaaagaggagtgagatcgtgaaggttagggagacccttttcccactccgttacacgttcttcgtctgttcgaac 217  Q
    |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||    
24159489 cgagctccggtgggatcaacgccatggaaagaggagtgagatcgtggaggttagggagacccttttcccactccgttacacgttcttcgtctgttcgaac 24159390  T
218 ctcttcacccattcagttattgtttcaactgtagcaaagttttcgggtcttgttggatttttggatccagaaagtcaaaagggatttggatttggatgag 317  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
24159389 ctcttcacccattcagttattgtttcaactgtagcaaagttttcgggtcttgttggatttttggatccagaaagtcaaaagggatttggatttggatgag 24159290  T
318 tgaatt 323  Q
    ||||||    
24159289 tgaatt 24159284  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University