View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14752_low_11 (Length: 390)
Name: NF14752_low_11
Description: NF14752
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14752_low_11 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 338; Significance: 0; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 338; E-Value: 0
Query Start/End: Original strand, 12 - 390
Target Start/End: Complemental strand, 38820890 - 38820520
Alignment:
| Q |
12 |
tattattcttgcagctgccctgtatcatctggcttaaactcaagaaacccaagaaatttggcttgtcttggacaattaattgggtaggttaattacgagc |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38820890 |
tattattcttgcagctgccctgtatcatctggcttaaactcaagaaacccaagaaatttggcttgtcttggacaattaattgggtaggttaattacgagc |
38820791 |
T |
 |
| Q |
112 |
atttaccaaactcaattagcacattaatgagactaattgattttgttcttttttcattttctattctatttcagatatgcattgttattggtgtcatgat |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38820790 |
atttaccaaactcaattagcacattaatgagactaattgattttgttcttttttcattttctattctatttcagatatgcattgttattggtgtcatgat |
38820691 |
T |
 |
| Q |
212 |
aatgacactatccccaattggtgctatgaggaatatcatcgttcaagccaagagctacaagtttttctcataaattatggaaacaaacattgatttctct |
311 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
38820690 |
aatgacactatccccaattggtgctatgaggaatatcatcgttcaagccaagagctacaagttcttctcataaattatggaaacaaacattgatttctct |
38820591 |
T |
 |
| Q |
312 |
cgctcactcaataattgatggatgaaactgagtactagtagagcgtcctagtaatctacatgcacaaacgagatgatat |
390 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||| ||||||||||||||||| ||||||||| |
|
|
| T |
38820590 |
cgctcactcaataattgatggatgaaactgagtactaggagagc--------aatctacatgcacaaactagatgatat |
38820520 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 34; Significance: 0.0000000006; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 32 - 97
Target Start/End: Original strand, 34410580 - 34410645
Alignment:
| Q |
32 |
tgtatcatctggcttaaactcaagaaacccaagaaatttggcttgtcttggacaattaattgggta |
97 |
Q |
| |
|
|||||||| ||||||||||| | ||||| |||| ||||||||||||||||| ||| ||||||||| |
|
|
| T |
34410580 |
tgtatcatatggcttaaactttacaaacctaagagatttggcttgtcttggataataaattgggta |
34410645 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University