View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14752_low_17 (Length: 294)
Name: NF14752_low_17
Description: NF14752
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14752_low_17 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 198; Significance: 1e-108; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 19 - 224
Target Start/End: Complemental strand, 29820471 - 29820266
Alignment:
| Q |
19 |
taaaccagggttgttgctctaacagtttcaatgtataggtatctctctctacgcttggatggtcgagttcgtgggagtggtgttggttatccaccttgga |
118 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
29820471 |
taaaccagggttgttgttctaacagtttcaatgtataggtatctctctctacgcttggatggtcgagttcgtggaagtggtgttggttatccaccttgga |
29820372 |
T |
 |
| Q |
119 |
atgctttcgttgcacaattaccgccggtaaagggaatctggactggcctactagatggcatggatggcagagtttagaagttcttttccatactcttgaa |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29820371 |
atgctttcgttgcacaattaccgccggtaaagggaatctggactggcctactagatggcatggatggcagagtttagaagttcttttccatactcttgaa |
29820272 |
T |
 |
| Q |
219 |
ggatga |
224 |
Q |
| |
|
|||||| |
|
|
| T |
29820271 |
ggatga |
29820266 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 241 - 277
Target Start/End: Complemental strand, 29820255 - 29820219
Alignment:
| Q |
241 |
atatacttctcccccttatacaaggagttcagcccta |
277 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
29820255 |
atatactcctcccccttatacaaggagttcagcccta |
29820219 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University