View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14752_low_21 (Length: 258)
Name: NF14752_low_21
Description: NF14752
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14752_low_21 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 226; Significance: 1e-124; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 226; E-Value: 1e-124
Query Start/End: Original strand, 15 - 252
Target Start/End: Original strand, 46675686 - 46675923
Alignment:
| Q |
15 |
aaattgaagggtttgttttgtgagtgtaatgagtgttcttaagatatgaaccattgggttggtatcaagattggtgacattttgattggatattgtggtt |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46675686 |
aaattgaagggtttgttttgtgagtgtaatgagtgttcttaagatatgaaccgttgggttggtatcaagattggtgacattttgattggatattgtggtt |
46675785 |
T |
|
| Q |
115 |
ttggcatttgaattgatcctgttgttcttaagatatgaattttggatttggttgtttagttgttatgtaaacctgaaaagcttaagattttcattttagt |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46675786 |
ttggcatttgaattgatcctgttgttcttaagatatgaattttggatttggttgtttagttgttatgtaaacctgaaaagcttaagattttcattttagt |
46675885 |
T |
|
| Q |
215 |
tttatcgcatctggaaagtttgtagtttttgatgatgt |
252 |
Q |
| |
|
||||||||||||||||||||| ||||||||||| |||| |
|
|
| T |
46675886 |
tttatcgcatctggaaagtttatagtttttgataatgt |
46675923 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University