View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14752_low_28 (Length: 218)
Name: NF14752_low_28
Description: NF14752
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14752_low_28 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 136; Significance: 4e-71; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 136; E-Value: 4e-71
Query Start/End: Original strand, 42 - 208
Target Start/End: Original strand, 35004087 - 35004253
Alignment:
| Q |
42 |
aaccaaaagatatccatttgtgttgtttccttgccctatataatagaaattcttcatggttatacaaagatgaatgatagagtgtgaatcacttatatca |
141 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35004087 |
aaccaaaagatatccatttgtgttgtttccttgccctatataatagaaattcttcatggttatacaaagatgaatgatagagtgtgaatcacttatatca |
35004186 |
T |
|
| Q |
142 |
aattttactnnnnnnnnnttgagcagtaaagagcttaatttggacgcacgtatatctttctctgctc |
208 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
35004187 |
aattttactaaaaaaaaattgagcagtaaagagcttaatttggacgcacgtatatctttctttgctc |
35004253 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University