View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14752_low_7 (Length: 432)
Name: NF14752_low_7
Description: NF14752
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14752_low_7 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 302; Significance: 1e-170; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 302; E-Value: 1e-170
Query Start/End: Original strand, 18 - 323
Target Start/End: Complemental strand, 24159589 - 24159284
Alignment:
| Q |
18 |
gttccggagttgcttcggaggagagaaagtgtgtttcgagaggcacggttaacgtcgaagagagtacggtgaggctccggggagatgctgaaagcggaag |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24159589 |
gttccggagttgcttcggaggagagaaagtgtgtttcgagaggcacggttaacgtcgaagagagtacggtgaggctccggggagatgctgaaagcggaag |
24159490 |
T |
|
| Q |
118 |
cgagctccggtgggatcaacgccatggaaagaggagtgagatcgtgaaggttagggagacccttttcccactccgttacacgttcttcgtctgttcgaac |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24159489 |
cgagctccggtgggatcaacgccatggaaagaggagtgagatcgtggaggttagggagacccttttcccactccgttacacgttcttcgtctgttcgaac |
24159390 |
T |
|
| Q |
218 |
ctcttcacccattcagttattgtttcaactgtagcaaagttttcgggtcttgttggatttttggatccagaaagtcaaaagggatttggatttggatgag |
317 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24159389 |
ctcttcacccattcagttattgtttcaactgtagcaaagttttcgggtcttgttggatttttggatccagaaagtcaaaagggatttggatttggatgag |
24159290 |
T |
|
| Q |
318 |
tgaatt |
323 |
Q |
| |
|
|||||| |
|
|
| T |
24159289 |
tgaatt |
24159284 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University