View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14753_low_6 (Length: 252)
Name: NF14753_low_6
Description: NF14753
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14753_low_6 |
 | |
|
| [»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 220; Significance: 1e-121; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 220; E-Value: 1e-121
Query Start/End: Original strand, 21 - 252
Target Start/End: Original strand, 7009169 - 7009400
Alignment:
| Q |
21 |
gaatggtctctggccatctccagcatcagattcagttgatttgtcggcatataagcttagatttggagactttgtccatgctttcttgtcggtggttgtg |
120 |
Q |
| |
|
||||||||||||||||||||| | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
7009169 |
gaatggtctctggccatctccgggatcagattcagttgatttgtcggcatataagcttagatttggagactttgtccatgctttcttgtcggtgattgtg |
7009268 |
T |
|
| Q |
121 |
ttcgcggtgctgggactgcttgacactaatgttgtgcattgcttttacccgaaatttgagtcgtctgagaagattctcatgcaggtgttaccaccggtta |
220 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7009269 |
ttcgcggtgctgggactgcttgacactaatgttgtgcattgcttttacccgaaatttgagtcgtctgagaagattctcatgcaggtgttaccaccggtta |
7009368 |
T |
|
| Q |
221 |
ttggggtggtttctggtgcggtgttcatgatt |
252 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
7009369 |
ttggggtggtttctggtgcggtgttcatgatt |
7009400 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University