View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14753_low_8 (Length: 205)
Name: NF14753_low_8
Description: NF14753
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14753_low_8 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 178; Significance: 3e-96; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 178; E-Value: 3e-96
Query Start/End: Original strand, 1 - 190
Target Start/End: Complemental strand, 38569782 - 38569593
Alignment:
| Q |
1 |
cctgggtttggacaaagactttatgagaatgtctgcaggttgatctttggtagaaatgtgagacatacagagttgacccaattgaacaagttgacgtaca |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38569782 |
cctgggtttggacaaagactttatgagaatgtctgcaggttgatctttggtagaaatgtgagacatacagagttgacccaattgaacaagttgacgtaca |
38569683 |
T |
 |
| Q |
101 |
taatggtagtcaagtgtgatatgcttcatttgagagtgaaaaactagattagagcataagtaggtgctctgatgttgtcacagaacagat |
190 |
Q |
| |
|
|||||||||||||||| ||||||||||||| |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38569682 |
taatggtagtcaagtgcgatatgcttcattcgagagtgaaaaactggattagagcataagtaggtgctctgatgttgtcacagaacagat |
38569593 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University