View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14755_low_12 (Length: 296)
Name: NF14755_low_12
Description: NF14755
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14755_low_12 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 98; Significance: 3e-48; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 98; E-Value: 3e-48
Query Start/End: Original strand, 12 - 125
Target Start/End: Original strand, 33253351 - 33253464
Alignment:
| Q |
12 |
attattctaatgtaaaatctcacgttattatgaccatgacataacagtatggacatggattaattaacattagtgtgctcgctttgtgaataatttgtgt |
111 |
Q |
| |
|
||||| |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
33253351 |
attatgctaatgtaaaatctcacgttattatgactatgacataacagtatggacatggattaattaacagcagtgtgctcgctttgtgaataatttgtgt |
33253450 |
T |
|
| Q |
112 |
gtttttcttagtga |
125 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
33253451 |
gtttttcttagtga |
33253464 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 215 - 279
Target Start/End: Original strand, 33253813 - 33253877
Alignment:
| Q |
215 |
ttttcattgtcctctttaacactaaatttggtccatctgttgttattatggataatgagggggac |
279 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33253813 |
ttttcattgtcctctttaacactaaatttggtccatctgttgttattatggataatgagggggac |
33253877 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 149 - 200
Target Start/End: Original strand, 33253462 - 33253513
Alignment:
| Q |
149 |
tgactatgccatattctctagagtagaatgtacataccagctactatagttc |
200 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33253462 |
tgactatgccatactctctagagtagaatgtacataccagctactatagttc |
33253513 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University