View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14756_low_15 (Length: 212)
Name: NF14756_low_15
Description: NF14756
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14756_low_15 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 180; Significance: 2e-97; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 180; E-Value: 2e-97
Query Start/End: Original strand, 10 - 197
Target Start/End: Original strand, 43665560 - 43665747
Alignment:
| Q |
10 |
tgagatgaagaaacagcttttcaaatttgcacagtagatatcacatgcttttgttttggtgaatggaaacacgtgaaagagtttgctgtaagcaccggcg |
109 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
43665560 |
tgagaggaagaaacagcttttcaaatttgcacagtagatatcacatgcttttgttttggtgaacggaaacacgtgaaagagtttgctgtaagcaccggcg |
43665659 |
T |
 |
| Q |
110 |
gcgtaaccgaggatgttaccgacggccataaaaaacgagaaaaacgcgtttgcgtttcttgttttttggtggttaccggcgcagaggt |
197 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43665660 |
gcgtaaccgaggatgttaccgacggccataaaaaacgagaaaaacgcgtttgcgtttcttgttttttggtggttaccggcgcagaggt |
43665747 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 56 - 138
Target Start/End: Complemental strand, 55076786 - 55076704
Alignment:
| Q |
56 |
gcttttgttttggtgaatggaaacacgtgaaagagtttgctgtaagcaccggcggcgtaaccgaggatgttaccgacggccat |
138 |
Q |
| |
|
||||| |||| |||||| ||||||| |||| ||||||||||| ||| |||||||| ||||| ||||| || || |||||||| |
|
|
| T |
55076786 |
gctttagtttgggtgaaaggaaacatgtgatagagtttgctgaaagagccggcggcataaccaaggatatttcccacggccat |
55076704 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University