View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14757_high_14 (Length: 313)
Name: NF14757_high_14
Description: NF14757
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14757_high_14 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 96; Significance: 4e-47; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 96; E-Value: 4e-47
Query Start/End: Original strand, 16 - 274
Target Start/End: Original strand, 29772209 - 29772474
Alignment:
| Q |
16 |
aatataagattgaatatgaaaattactaatcgcaattataagcataggtcataatagtctttcannnnnnnnnaaacaataatagtatttcannnnnnnn |
115 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||| |||||||||||| |||||||| ||||||||||||||||||| |
|
|
| T |
29772209 |
aatataagattgaatatgaaaattattaatcgcaattataaatataggtcataatggtctttcatttttctt-aaacaataatagtatttcatttttttt |
29772307 |
T |
 |
| Q |
116 |
ngaaggataattgtatt-aatttttgtaaattggaaaatacatannnnnnnnn-------agggatggaaaatacatatttgaaattcttaaa-tatcac |
206 |
Q |
| |
|
|||||||||||| || ||||||||||||||||||||||| | ||||||||||||||||||||||||| ||||||| |||||| |
|
|
| T |
29772308 |
aaaaggataattgtgtttaatttttgtaaattggaaaatacttttttttttttttttttgagggatggaaaatacatatttgaaa-tcttaaattatcac |
29772406 |
T |
 |
| Q |
207 |
atattcacatttacgttggcttccagtgctactgtttctcgttgcaactttaccaaaagagatgtaac |
274 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29772407 |
atattcacatttacgttggcttccagtgctgctgtttctcgttgcaactttaccaaaagagatgtaac |
29772474 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University