View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14757_low_16 (Length: 324)
Name: NF14757_low_16
Description: NF14757
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14757_low_16 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 288; Significance: 1e-161; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 288; E-Value: 1e-161
Query Start/End: Original strand, 16 - 307
Target Start/End: Complemental strand, 3107143 - 3106852
Alignment:
| Q |
16 |
tactttcaatggctagcttaataatgtagattgattgatggtcgttggggaatattgtttaggtgctcggtatagagttactacgtcaacccacagagag |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3107143 |
tactttcaatggctagcttaataatgtagattgattgatggtcgttggggaatattgtttaggtgctcggtatagagttactacgtcaacccacagagag |
3107044 |
T |
 |
| Q |
116 |
acgtagacagggtcacatggaaatttatggcacaaagcactaagacacatatggttaagcgtgtgacttgtgatgcaaataaagttaaacctatctcacg |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3107043 |
acgtagacagggtcacatggaaatttatggcacaaagcactaagacacatatggttaagcgtgtgacttgtgatgcaaataaagttaaacctatctcacg |
3106944 |
T |
 |
| Q |
216 |
agcagagcagattggtaaatatatatgggcatcgagcttggagttccccaagaaagaagcaaccaactttgtcccttttctcattttgcatt |
307 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
3106943 |
agcagagcagattggtaaatatatatgggcatcgagcttggagttccccaagaaagaagcaaccaactttgtcacttttctcattttgcatt |
3106852 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University